View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16701_low_25 (Length: 290)
Name: NF16701_low_25
Description: NF16701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16701_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 19 - 225
Target Start/End: Original strand, 17595546 - 17595752
Alignment:
| Q |
19 |
gttggtttgtgttatcatgatcttgttgatttcttccaagattgtgagcactgtagttgctacaagtatatatggaatgtctcttagagatagtatggct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17595546 |
gttggtttgtgttatcatgatcttgttgatttcttccaagattgtgagcactgtagttgctacaagtatatatggaatgtctcttagagatagtatggct |
17595645 |
T |
|
| Q |
119 |
cttggagtgctcatgaatactaaaggtgtcttgtcattgattatactaaacattggatgggatagaaaggtattattcatttacttgtatatacacatta |
218 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
17595646 |
cttggagtgctcatgaatacaaaaggtgtcttatcattgattgtactaaacattggatgggatagaaaggtattattcatttctttgtatatatacatta |
17595745 |
T |
|
| Q |
219 |
ttgttac |
225 |
Q |
| |
|
||||||| |
|
|
| T |
17595746 |
ttgttac |
17595752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 242 - 280
Target Start/End: Original strand, 17595740 - 17595778
Alignment:
| Q |
242 |
acattattgttacttgataaaaccttttgttaccctttg |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17595740 |
acattattgttacttgataaaaccttttgttaccctttg |
17595778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University