View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16701_low_29 (Length: 267)
Name: NF16701_low_29
Description: NF16701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16701_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 20 - 262
Target Start/End: Original strand, 33585347 - 33585589
Alignment:
| Q |
20 |
ctataaaagagagactacttaactattattcaccattgagtcactttgttttacaacacaattacaaaataatggaaaaaatgatcaatatactattctt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33585347 |
ctataaaagagagactacttaactattattcaccattgagtcactttgttttacaacataattacaaaataatggaaaaaatgatcaatatactattctt |
33585446 |
T |
 |
| Q |
120 |
tttaatttatttggtggctggcattactggccatcgaattgatagtatgcgaagcaaggtgaaagaggatttggatatcgagagagagctcaagcttatt |
219 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33585447 |
tttcatttatttggtggctggcattactggccatcgaattgatagtatgcgaagcaaggtgaaagaggatttggatatcgagagagagctcaagcttatt |
33585546 |
T |
 |
| Q |
220 |
aataaagctcctatcaagagtattcatgtattccatactcttc |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33585547 |
aataaagctcctatcaagagtattcatgtattccatactcttc |
33585589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University