View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16701_low_31 (Length: 260)
Name: NF16701_low_31
Description: NF16701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16701_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 18 - 160
Target Start/End: Original strand, 48692519 - 48692661
Alignment:
| Q |
18 |
ttaacataatggatgtgggttttgttttcgggattcctggattgtgccggatcaattgcccacgtttatataattttctccttttcatgaggatatgatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48692519 |
ttaacataatggatgtgggttttgttttcgggattcctggattgtgccggatcaattgcccacgtttatataattttctccttttcatgaggatatgatg |
48692618 |
T |
 |
| Q |
118 |
agaccgtggttcnnnnnnngttatcaacggttcgattctcggg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
48692619 |
agaccgtggttctttttttgttatcaacggttcgattcacggg |
48692661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 218 - 260
Target Start/End: Original strand, 48692730 - 48692772
Alignment:
| Q |
218 |
caattcatcatacagtaatattttttgatggaattcatcaaat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48692730 |
caattcatcatacagtaatattttttgatggaattcatcaaat |
48692772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University