View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16701_low_36 (Length: 247)

Name: NF16701_low_36
Description: NF16701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16701_low_36
NF16701_low_36
[»] chr8 (3 HSPs)
chr8 (12-228)||(27065616-27065832)
chr8 (12-228)||(27079333-27079549)
chr8 (16-210)||(27053192-27053386)


Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 228
Target Start/End: Complemental strand, 27065832 - 27065616
Alignment:
12 tgagatgaagcaggtttttaaggtgtccgagaattcttcgatgaacaaaatgatggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaa 111  Q
    |||||||||||| ||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||    
27065832 tgagatgaagcaagttttcaaggtgtccgagaattcttcgatgaataagatgatggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaa 27065733  T
112 acgaagcgttgtgtgggttctcttgaggatatgattgattttgcaacttctgttttgggtcacagtgttactgttcgatccactgagaatgtaaatgggg 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
27065732 acgaagcgttgtgtgggttctcttgaggatatgattgattttgcaacttctgttttgggtcacagtgttactgttcggtccactgagaatgtaaatgggg 27065633  T
212 cgggcaaggatgtcatg 228  Q
    |||||||||||||||||    
27065632 cgggcaaggatgtcatg 27065616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 12 - 228
Target Start/End: Complemental strand, 27079549 - 27079333
Alignment:
12 tgagatgaagcaggtttttaaggtgtccgagaattcttcgatgaacaaaatgatggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaa 111  Q
    |||| ||||||| |||||||||||||| |||||||| |||||| | || ||||| |||||  | ||| ||||||| |||||||| |||||| | |||||     
27079549 tgagttgaagcaagtttttaaggtgtctgagaattcctcgatggataagatgatagtggactcattgggtgagtgtgagagggcaccgagtatgggtgag 27079450  T
112 acgaagcgttgtgtgggttctcttgaggatatgattgattttgcaacttctgttttgggtcacagtgttactgttcgatccactgagaatgtaaatgggg 211  Q
    || ||||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||| ||   ||| ||||||||||| ||||||| |||||||||      
27079449 acaaagcgttgtgttggttcacttgaggatatgattgactttgcaacttcagttttgggccatgatgtaactgttcgatcaactgagagtgtaaatggat 27079350  T
212 cgggcaaggatgtcatg 228  Q
    |||||||  ||||||||    
27079349 cgggcaaaaatgtcatg 27079333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 16 - 210
Target Start/End: Complemental strand, 27053386 - 27053192
Alignment:
16 atgaagcaggtttttaaggtgtccgagaattcttcgatgaacaaaatgatggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaaacga 115  Q
    |||||||| ||||| |||||||| || ||||| |  ||| | || ||||| |||||  | ||||||||||| || || ||||| |||  |||||| |  |    
27053386 atgaagcaagttttcaaggtgtctgaaaattcctttatggaaaagatgatagtggactcattgagtgagtgtgaaagagcgccaagtaaaggtgagatca 27053287  T
116 agcgttgtgtgggttctcttgaggatatgattgattttgcaacttctgttttgggtcacagtgttactgttcgatccactgagaatgtaaatggg 210  Q
    |||||||||| ||||| |||||||| |||||||| |||||||||||| ||||||||  || ||| || ||||| |||||||||||||||||||||    
27053286 agcgttgtgtaggttcgcttgaggacatgattgactttgcaacttctattttgggtagcaatgtgacggttcggtccactgagaatgtaaatggg 27053192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University