View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16701_low_37 (Length: 247)
Name: NF16701_low_37
Description: NF16701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16701_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 27641478 - 27641709
Alignment:
| Q |
1 |
tgtcctcttaatatagtggtaaattctggatccatcactgttttgtaagttgtggtaaattattaatatagttgtagatagatgtcaacaaagttgaacg |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27641478 |
tgtcttcttaatatagtggtaaattctggatccatcactgttttgtaagttgtggtaaattattaatatagttgtagatagatgtcaacaaagttgaacg |
27641577 |
T |
 |
| Q |
101 |
aatgcatttcttcnnnnnnnnnnnngttgaacgaatgcatgaaaaacatatggttatttaaatgaaaaccagaaatcagtcaaataaacgtgaggcatta |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27641578 |
aatgcatttcttcaaaaacaaaaaagttgaacgaatgcatgaaaaacatatggttatttaaatgaaaaccagaaatcagtcaaataaacgtgaggcatta |
27641677 |
T |
 |
| Q |
201 |
ggaaatttgtacagaatcacaaatagtgctct |
232 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |
|
|
| T |
27641678 |
ggaaatttgtatagaatcacaaatagtgctct |
27641709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University