View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16702_high_36 (Length: 348)
Name: NF16702_high_36
Description: NF16702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16702_high_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 9 - 261
Target Start/End: Original strand, 4607839 - 4608087
Alignment:
| Q |
9 |
gaagaaaatatactcaaatgggtttttgaaatgaaactatactcaatgagttttttgaactagaagaaaactctttctaactagctagctcacgggtttc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4607839 |
gaagaaaatatactcaaatgggtttttgaaatgaaactatactcaatgagttttttgaactagaagaaaactctttctaactag----ctcacgggtttc |
4607934 |
T |
|
| Q |
109 |
tttgttttttagtgggtatctttcatacgtaatagtacacattgttccagaaagttttccaattgttgttggaaccatttgacagtgattttttagattg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4607935 |
tttgttttttagtgggtatctttcatacgtaatagtacacattgttccagaaagttttccaattgttgttggaaccatttgccagtgattttttagattg |
4608034 |
T |
|
| Q |
209 |
ttattgggtgagttgaaagtactttttgaatttaagattagatatcatatgaa |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608035 |
ttattgggtgagttgaaagtactttttgaatttaagattagatatcatatgaa |
4608087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 306 - 348
Target Start/End: Original strand, 4608132 - 4608174
Alignment:
| Q |
306 |
cctatgattaatgttattatgttttgtctctaattcttgtctc |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608132 |
cctatgattaatgttattatgttttgtctctaattcttgtctc |
4608174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University