View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16702_high_61 (Length: 257)
Name: NF16702_high_61
Description: NF16702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16702_high_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 5 - 239
Target Start/End: Original strand, 43537763 - 43538001
Alignment:
| Q |
5 |
catgtatgataattgaccttccatcaatgcatgcttgacccagccattatttaccgtacacgtgttaggaacttatggtgtttttcattttccatgcaat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43537763 |
catgtatgataattgaccttccatcaatgcatgcttgacccagccattatttaccgtacacgtgttaggaacttatggtgtttttcattttccatgcaat |
43537862 |
T |
 |
| Q |
105 |
tgtaagactttggacacatcgtatgtgaaatagatttttgttgtcaaataatcacac----tatgaaaccatattagctggttttgattggtgagtatgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43537863 |
tgtaagactttggacacatcgtatgtgaaatagatttttgttgtcaaataatcacactatatatgaaaccatattagctggttttgattggtgagtatgg |
43537962 |
T |
 |
| Q |
201 |
ctcataggcacaaaagatcggtaaggagcgagagagttg |
239 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43537963 |
ctcataggcacaaaagatcggtaaggggcgagagagttg |
43538001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University