View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16702_high_68 (Length: 238)
Name: NF16702_high_68
Description: NF16702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16702_high_68 |
 |  |
|
| [»] scaffold0197 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0197 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: scaffold0197
Description:
Target: scaffold0197; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 23254 - 23050
Alignment:
| Q |
19 |
ggtgttaggtttattggtaaccttgttgatatagaagatcgtttagatgttgaaatctatgaccctcttttgggttcttgggatttagctcctcctcttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23254 |
ggtgttaggtttattggtaaccttgttgatatagaagatcgtttagatgttgaaatctatgaccctcttttgggttcttgggatttagctcctcctcttc |
23155 |
T |
 |
| Q |
119 |
ctgttgattttcgatctggaaactcatcatcttcactttcatctgctttgttcaaagggaagttttttgtgtttgggatatattcatgttttgtttcttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23154 |
ctgttgattttcgatctggaaactcatcatcttcactttcatctgctttgttcaaagggaagttttttgtgtttgggatatattcatgttttgtttcttc |
23055 |
T |
 |
| Q |
219 |
ctttg |
223 |
Q |
| |
|
||||| |
|
|
| T |
23054 |
ctttg |
23050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 21309639 - 21309435
Alignment:
| Q |
19 |
ggtgttaggtttattggtaaccttgttgatatagaagatcgtttagatgttgaaatctatgaccctcttttgggttcttgggatttagctcctcctcttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21309639 |
ggtgttaggtttattggtaaccttgttgatatagaagatcgtttagatgttgaaatctatgaccctcttttgggttcttgggatttagctcctcctcttc |
21309540 |
T |
 |
| Q |
119 |
ctgttgattttcgatctggaaactcatcatcttcactttcatctgctttgttcaaagggaagttttttgtgtttgggatatattcatgttttgtttcttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21309539 |
ctgttgattttcgatctggaaactcatcatcttcactttcatctgctttgttcaaagggaagttttttgtgtttgggatatattcatgttttgtttcttc |
21309440 |
T |
 |
| Q |
219 |
ctttg |
223 |
Q |
| |
|
||||| |
|
|
| T |
21309439 |
ctttg |
21309435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University