View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16702_high_80 (Length: 211)
Name: NF16702_high_80
Description: NF16702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16702_high_80 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 17 - 194
Target Start/End: Original strand, 45515521 - 45515704
Alignment:
| Q |
17 |
tcatatttcacatggaacttctcaaacaaaaggtgatg------aagatgaagatggggtagaaaaagtatggttctacttcgtcatagcgctcggtttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45515521 |
tcatatttcacatggaacttctcaaacaaaaggtgatgaagatgaagatgaagatggggtagaaaaagtatggttctacttcgtcatagcgctcggtttt |
45515620 |
T |
 |
| Q |
111 |
gcaactggcttatggggagttattggcactttgtggttcaagaagaattggagacatgcttacttcagatgggttgaagatatt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45515621 |
gcaactggcttatggggagttattggcactttgtggttcaagaagaattggagacatgcttacttcagatgggttgaagatatt |
45515704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 120 - 191
Target Start/End: Original strand, 4474969 - 4475040
Alignment:
| Q |
120 |
ttatggggagttattggcactttgtggttcaagaagaattggagacatgcttacttcagatgggttgaagat |
191 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| | |||||| |||||||| |||||| |
|
|
| T |
4474969 |
ttatggggagttattggcactttctggttcaagaagaattggagacaagattactttagatgggtggaagat |
4475040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University