View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16702_low_40 (Length: 348)
Name: NF16702_low_40
Description: NF16702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16702_low_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 333
Target Start/End: Complemental strand, 50530470 - 50530138
Alignment:
| Q |
1 |
acaaaaccaaagagcgcacgcaatgacaagccatggctcatcgttttcgagcctcccaaactatctccaagccgtcgctaaaactccctctcgctttgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50530470 |
acaaaaccaaagagcgcacgcaatgacaagccatggctcatcgttttcgagcctcccaaactatctccaagccgtcgctaaaactccctctcgctttgct |
50530371 |
T |
 |
| Q |
101 |
cgtcgcggcttctccgtctccacttcttacgaagaaatgagccgcgttcgagctaggtccggtaacagcatgcgcaaaaccctccgttggtttgacttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50530370 |
cgtcgcggcttctccgtctccacttcttacgaagaaatgagccgtgttcgagctaggtccggcaacagcatgcgcaaaagcctccgttggtttgacttag |
50530271 |
T |
 |
| Q |
201 |
tcagctttggtatcggtggaatggtcggcgccggagtcttcgtcaccactggccacgctacccgtgttcacgctggcccttccgttgttctatcttacgc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50530270 |
tcagctttggtatcggtggaatggtcggcgccggagtcttcgtcaccactggccacgctacccgtgttcacgctggcccttccgttgttctatcttacgc |
50530171 |
T |
 |
| Q |
301 |
cattgccggtttctgtgctctcctctctgcctt |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
50530170 |
cattgccggtttctgtgctctcctctctgcctt |
50530138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University