View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16702_low_48 (Length: 319)
Name: NF16702_low_48
Description: NF16702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16702_low_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 15 - 303
Target Start/End: Complemental strand, 29062363 - 29062075
Alignment:
| Q |
15 |
aatattatcctctcctaaagcgtttgataatgggatcatagttccaatattgtcaacgatatcagaggaaagatggggagtaaaattctcaacatccgaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29062363 |
aatattatcctctcctaaagcgtttgatagtgggatcatagttccaatcttgtcaacgatatcagaggaaagatggggagtaaaattctcaacatccgaa |
29062264 |
T |
 |
| Q |
115 |
tcaccattatctctcacaaagcaacacaatggtgtatttaaattttgaacgttaatgtcatccctccgaagagggcaaagattcttaatattagaaatat |
214 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29062263 |
tcaccattatctctcacaaagcgacacaatggtgtatttaaattttgaacgttaatgtcatccttccgaagagggcaaaaattcttaatattagaaatat |
29062164 |
T |
 |
| Q |
215 |
gattatcattgtcttcgtaaaataatatcttcttaaacaacactttcaaaaatttccaggcttaagaaaatatgaatcaagtaaccaac |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29062163 |
gattatcattgtcttcgtaaaataatatcttcttaaacaacactttcaaaaatttacaggcttaagaaaatatgaatcaagtaaccaac |
29062075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University