View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16702_low_67 (Length: 259)
Name: NF16702_low_67
Description: NF16702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16702_low_67 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 59 - 216
Target Start/End: Complemental strand, 5529610 - 5529451
Alignment:
| Q |
59 |
ggaaaattaaatttaatatgttcaagcccaatgagagnnnnnnnnnnc-ctttccaaatcgattattgttttcaccaacggcatatcttaatcgagagat |
157 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5529610 |
ggaagattaaatttaatatgttcaagcccaatgagagtgttttttttttctttccaaatcgattcttgttttcaccaacggcatatcttaatcgagagat |
5529511 |
T |
 |
| Q |
158 |
agataatatt-ttttaaggttgaaaaataaaaagagtatattggtttttatctttataat |
216 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5529510 |
agataatatttttttaaggttgaaaaataaaaagagtatattggtttttatctttataat |
5529451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University