View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16702_low_71 (Length: 253)
Name: NF16702_low_71
Description: NF16702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16702_low_71 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 231
Target Start/End: Complemental strand, 35557654 - 35557442
Alignment:
| Q |
20 |
atgctacaactaaaatatcatgtatgcttaagt-ataatgtgtcactaactcactgttgttttgacaaatgctatactctaaagcttcaacaaaattaca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
35557654 |
atgctacaactaaaatatcatgtatgcttaagttataatgtgtcagtaactcactgttgttttgacgaatgttatactctaaagcttcaacaaaattaca |
35557555 |
T |
|
| Q |
119 |
gtgttgccgtaatttcatcaaaatcaccttgatttccacatgcaccgaaacacaggtagattttatttgcaacttctctttttatccactggtttgaact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35557554 |
atgttgccgtaatttcatcaaaatcaccttgatttccacatgcactgaaacacaggtagattttatttgcaacttctctttttatccactggtttgaact |
35557455 |
T |
|
| Q |
219 |
acacaccaaatca |
231 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35557454 |
acacaccaaatca |
35557442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University