View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16702_low_72 (Length: 253)
Name: NF16702_low_72
Description: NF16702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16702_low_72 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 5 - 252
Target Start/End: Original strand, 43537505 - 43537760
Alignment:
| Q |
5 |
attgcttgagaagaaaatcgcgggattatatgaaaatggaatggatatataacaatcatgtggagcaaaactctatataaaggccagttaagagattaga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43537505 |
attgcttgagaagaaaatcgcgggattatatgaaaatggaatggatctataacaatcatgtggagcaaaactctatataaaggccagttaagaggttaga |
43537604 |
T |
 |
| Q |
105 |
gctttatggatacaactaccaaaatacccttctagttgggtcc--------aatatatataattatgttatgttgtggttttgtctactcatataattga |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43537605 |
gctttatggatacaactaccaaaatacccttctagttgggtcctatatatatatatatataattatgttatgttgtggttttgtctactcatataattga |
43537704 |
T |
 |
| Q |
197 |
gcacgtctttgtgataagtactgaacttgcgacatgaaagatgtaattacatgtat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43537705 |
gcacgtctttgtgataagtactgaacttgcgacatgaaagatgtaattacatgtat |
43537760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University