View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16702_low_86 (Length: 226)
Name: NF16702_low_86
Description: NF16702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16702_low_86 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 41990532 - 41990756
Alignment:
| Q |
1 |
taaaattgggaaaaaattactgtcatgtcactcatactttactaaaattacatagactttttctacatagaaatctgctattaagcaaaggaaatttgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41990532 |
taaaattgggaaaaaattactgtcatgtcactcatactttactaaaattacatagactttttctacatagaaatctgctattaagcaaaggaaaattgca |
41990631 |
T |
 |
| Q |
101 |
atatgacatgaagaagaatttagtgtcaaatattacgtagcaccaactctcctgatcaaaagtgtgttcggtgtctgacatgtgccgatgtcaaatgcga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| | |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41990632 |
atatgacatgaagaagaatttagtgtcaaatattatgtagcatc-actctcctgatcaaaagtgtgttcggtgtctgacatgtgctgatgtcaaatgcga |
41990730 |
T |
 |
| Q |
201 |
cacatgtgattacactcaattaattc |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41990731 |
cacatgtgattacactcaattaattc |
41990756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University