View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16702_low_88 (Length: 223)
Name: NF16702_low_88
Description: NF16702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16702_low_88 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 13 - 223
Target Start/End: Complemental strand, 34571001 - 34570791
Alignment:
| Q |
13 |
catcagttttgtatgtggaagtttttgattttgacggtccatttgaccaggatgtttcacttggacatgctgagatcaatttcctaaagcatacatccac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34571001 |
catcagttttgtatgtggaagtttttgattttgacggtccatttgaccaggatgtttcacttggacatgctgagatcaatttcctaaagcatacatccac |
34570902 |
T |
 |
| Q |
113 |
agaattggcagacatgtggctcgtgcttgaaggaaaactcgcccaatctgctcaatcgaaattgcatttgagaattttcttggacaataacaaaggagtt |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34570901 |
agaattggcagacatgtgggtcgtgcttgaaggaaaactcgcccaatctgctcaatcgaaattgcatttgagaattttcttggacaataacaaaggagtt |
34570802 |
T |
 |
| Q |
213 |
gaaattatcaa |
223 |
Q |
| |
|
| ||||||||| |
|
|
| T |
34570801 |
gcaattatcaa |
34570791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University