View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16702_low_92 (Length: 211)
Name: NF16702_low_92
Description: NF16702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16702_low_92 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 58 - 188
Target Start/End: Original strand, 11612208 - 11612338
Alignment:
| Q |
58 |
ttaattccccatatgaaaccgttgaacatttttcaactttcacactagcttccaccacaaattcatgaagaatatgaaccactttatcacaatcacaatt |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612208 |
ttaattccccatatgaaaccgttgaacatttttcaactttcacactagcttccaccacaaattcatgaagaatatgaaccactttatcacaatcacaatt |
11612307 |
T |
|
| Q |
158 |
cacaattcagaataccctcttgagttttgat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
11612308 |
cacaattcagaataccctcttgagttttgat |
11612338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University