View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16702_low_93 (Length: 204)
Name: NF16702_low_93
Description: NF16702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16702_low_93 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 6 - 75
Target Start/End: Complemental strand, 44823292 - 44823223
Alignment:
| Q |
6 |
tttctttcttggaatcagcttatgtatatattataaacaccaatatcatacaagacgtgggataggggac |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44823292 |
tttctttcttggaatcagcttatgtatatattataaacaccaatatcatacaagatgtgggataggggac |
44823223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 173 - 204
Target Start/End: Complemental strand, 44823125 - 44823094
Alignment:
| Q |
173 |
atgtaatttcaacaaacaaaccttgtaaacca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44823125 |
atgtaatttcaacaaacaaaccttgtaaacca |
44823094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University