View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16703_high_33 (Length: 358)
Name: NF16703_high_33
Description: NF16703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16703_high_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 341
Target Start/End: Complemental strand, 5461102 - 5460762
Alignment:
| Q |
1 |
ttttgtaatggaaaaactgagattgggatatgtggtacatgcaacagtactgtaaaagcagcacatagtcggtgttggaatgatcatctttcaccttcga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5461102 |
ttttgtaatggaaaaactgagattgggatatatggtacatgcaacagtactataaaagcagcacatagtcggtgttggaatgatcatctttcaccttcga |
5461003 |
T |
 |
| Q |
101 |
gatattgcgatgagaaaaggggaagggtggtggtaaccttggccattggtggaaagtaggaatgtgtactaaaggttctgccataattatttaatattta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
5461002 |
gatattgcgatgagaaaaggggaagggtggtggtaatcttggccattggtggaaagtaggaatgtgta-ttaaggttctgccataattatttaatattta |
5460904 |
T |
 |
| Q |
201 |
tctcttaatttgaaattaataacactcagatgctcaaaatctattctttatggaactaatttctcttaaaaaacaagtgctcaaaaggatttcc-gtttc |
299 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
5460903 |
tcacttaatttgaaattaataacactcagatgctcaaaatctattctttatggaattgatttctcttcaaaaacaagtgctcaaaaggatttcctctttc |
5460804 |
T |
 |
| Q |
300 |
ctactatggtttaccacaatattcaacaccatcgactttttg |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5460803 |
ctactatggtttaccacaatattcaacaccatcgactttttg |
5460762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000003; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 172 - 219
Target Start/End: Complemental strand, 24864654 - 24864607
Alignment:
| Q |
172 |
aaggttctgccataattatttaatatttatctcttaatttgaaattaa |
219 |
Q |
| |
|
|||||||| |||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
24864654 |
aaggttctaccattatcatttaatatttatctcttaatttgaaattaa |
24864607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 88 - 140
Target Start/End: Complemental strand, 24866416 - 24866364
Alignment:
| Q |
88 |
ctttcaccttcgagatattgcgatgagaaaaggggaagggtggtggtaacctt |
140 |
Q |
| |
|
||||||||||||||||| | ||||| ||||||||||||||||||||| |||| |
|
|
| T |
24866416 |
ctttcaccttcgagatacagagatgataaaaggggaagggtggtggtatcctt |
24866364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 67 - 166
Target Start/End: Complemental strand, 24052333 - 24052234
Alignment:
| Q |
67 |
agtcggtgttggaatgatcatctttcaccttcgagatattgcgatgagaaaaggggaagggtggtggtaaccttggccattggtggaaagtaggaatgtg |
166 |
Q |
| |
|
|||||||||||||||| | | |||||||||| || ||| | | |||||||||||||||||||| ||| ||||| ||| |||| ||||||| |||||| |
|
|
| T |
24052333 |
agtcggtgttggaatgttgacctttcaccttagacatagagaggtgagaaaaggggaagggtggcagtacccttgaccaccggtgaaaagtagcaatgtg |
24052234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 88 - 145
Target Start/End: Original strand, 8365055 - 8365112
Alignment:
| Q |
88 |
ctttcaccttcgagatattgcgatgagaaaaggggaagggtggtggtaaccttggcca |
145 |
Q |
| |
|
|||||||||| |||||| | ||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
8365055 |
ctttcacctttgagatagagagatgaaaaaaggggaagggtggtggtatccttggcca |
8365112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 87 - 143
Target Start/End: Complemental strand, 1968323 - 1968267
Alignment:
| Q |
87 |
tctttcaccttcgagatattgcgatgagaaaaggggaagggtggtggtaaccttggc |
143 |
Q |
| |
|
|||||||||||| ||||| | |||| ||||||||||||||||||||| ||||||| |
|
|
| T |
1968323 |
tctttcaccttcaagatagagaaatgaaaaaaggggaagggtggtggtatccttggc |
1968267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University