View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16703_high_57 (Length: 206)
Name: NF16703_high_57
Description: NF16703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16703_high_57 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 52422022 - 52421846
Alignment:
| Q |
19 |
gcatggttgaatgatgggagctgaaggttgcaagacgtggacgcttggagcgtgtacgtctcactgtggtcttttcacaagtgggtgaactattgctttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52422022 |
gcatggttgaatgatgggagctgaaggttgcaagacgtggacgcttggagcgtgtacgtctcactgtggtcttttcacaagtgggtgaactattgctttt |
52421923 |
T |
|
| Q |
119 |
agggagcacaaaatcctccttgttgactgatgatgatggatgttgctccacttttttcattgtaatattcttatcac |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52421922 |
agggagcacaaaatcctccttgttgactgatgatgatggatgttgctccacttttttcattgtaatattctcatcac |
52421846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 97; Significance: 7e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 14150595 - 14150419
Alignment:
| Q |
19 |
gcatggttgaatgatgggagctgaaggttgcaagacgtggacgcttggagcgtgtacgtctcactgtggtcttttcacaagtgggtgaactattgctttt |
118 |
Q |
| |
|
||||||||||| || | | |||||||||||||||| |||||||||||| |||||||||||||| ||||||||||||| || ||||||||| |||||| |
|
|
| T |
14150595 |
gcatggttgaacgaggtgggctgaaggttgcaagatgtggacgcttggtgcgtgtacgtctcattgtggtcttttcatgagcaggtgaactactgctttc |
14150496 |
T |
|
| Q |
119 |
agggagcacaaaatcctccttgttgactgatgatgatggatgttgctccacttttttcattgtaatattcttatcac |
195 |
Q |
| |
|
| ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| ||| | ||||| ||||| |
|
|
| T |
14150495 |
aaggagcacaaaatcctccttgttgaccgatgatgatggttgttgctccacttttttcactgtgagattctcatcac |
14150419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 38 - 177
Target Start/End: Original strand, 14151098 - 14151237
Alignment:
| Q |
38 |
gctgaaggttgcaagacgtggacgcttggagcgtgtacgtctcactgtggtcttttcacaagtgggtgaactattgcttttagggagcacaaaatcctcc |
137 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||| ||| ||||||||||| | ||||||||||||| |||||| | ||||||||||||||||| |
|
|
| T |
14151098 |
gctgaagcttgcaggacgtggacgcttggagcgtgtacgtatcattgtggtctttttatgagtgggtgaactactgctttcatggagcacaaaatcctcc |
14151197 |
T |
|
| Q |
138 |
ttgttgactgatgatgatggatgttgctccacttttttca |
177 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14151198 |
ttgtagactgatgatgatggttgttgctccacttttttca |
14151237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 19 - 177
Target Start/End: Original strand, 24482332 - 24482488
Alignment:
| Q |
19 |
gcatggttgaatgatgggagctgaaggttgcaagacgtggacgcttggagcgtgtacgtctcactgtggtcttttcacaagtgggtgaactattgctttt |
118 |
Q |
| |
|
||||||||||| || || ||||| ||||| || ||| ||||||||||||| |||||||||||| ||| |||||| ||| ||||||||||||| |||||| |
|
|
| T |
24482332 |
gcatggttgaacga-ggaagctgcaggtt-catgacatggacgcttggagtgtgtacgtctcattgtagtctttccaccagtgggtgaactactgctttc |
24482429 |
T |
|
| Q |
119 |
agggagcacaaaatcctccttgttgactgatgatgatggatgttgctccacttttttca |
177 |
Q |
| |
|
| ||||||| ||||||||||||||||| ||||||||||| ||||||| ||||||||||| |
|
|
| T |
24482430 |
aaggagcaccaaatcctccttgttgaccgatgatgatggttgttgcttcacttttttca |
24482488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University