View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16703_low_41 (Length: 292)
Name: NF16703_low_41
Description: NF16703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16703_low_41 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 8 - 276
Target Start/End: Complemental strand, 13766225 - 13765957
Alignment:
| Q |
8 |
tcagctttcaacatatttcgcaaccgtgtaaagaagttgagattaaatccgtccggtatagggatctcgttaccatccacactagaaaccaccaattcca |
107 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13766225 |
tcagctttcaacatatttcgcaaccgtataaagaagttgagattaaatccgtccggcctagggctctcgttaccatccagactagaaaccaccaattcca |
13766126 |
T |
 |
| Q |
108 |
tttttgaaaccaagactagagctaacaacaggacattatccaaattagaaatatgaatgaaatcaatatcgaccatggtcggtctataggtctatgggtc |
207 |
Q |
| |
|
||||||||||||||| | ||||| ||||||| ||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13766125 |
tttttgaaaccaagaattgagctgacaacagaacattatccaaattagaaatatgaaagaaatcaatatcgcccatggtcggtctataggtctatgggtc |
13766026 |
T |
 |
| Q |
208 |
tgagaaatgatgcgtaaagaaattcacaatcgcttgtttgatctttgcaacatcctccatccacctttc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
13766025 |
tgagaaatgatgcgtaaagaaattcacaatcgcttgtttgttctttgcaacatcatccatccacctttc |
13765957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University