View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16703_low_43 (Length: 283)
Name: NF16703_low_43
Description: NF16703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16703_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 52095282 - 52095017
Alignment:
| Q |
1 |
tggttggtgtgctgcaatattgttggatcatttgatatgctgaaattcttcttaatcttgtctgttatgttgtattggttggttaagcagtcagtctgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52095282 |
tggttggtgtgctgcaatattgttggatcgtttgatatgctgaaattcttcttaatcttgtctgttatgttgtattggttggttaagcagtcagtctgtt |
52095183 |
T |
 |
| Q |
101 |
ttgacattatagcagcggtaaggtttggtttatccgattttaaacattctgcactggtttttagtggagtatgctacccagagttttgggttatagtttc |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52095182 |
ttgacattataacagcggtaaggtttggtttatccgattttaaacattctgcactggtttttagtggagtatgctacccagagttttgggttatagtttc |
52095083 |
T |
 |
| Q |
201 |
tataagatacgattttgaatatcatgctggagaagtctcatctgatcctacatcggtagctccttc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52095082 |
tataagatacgattttgaatatcatgctggagaagtctcatctgatcctacatcggtagctccttc |
52095017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 38 - 208
Target Start/End: Complemental strand, 36410778 - 36410603
Alignment:
| Q |
38 |
tgctgaaattcttcttaatcttgtctgttatgttgtattggttggtt----aagcagtca--gtctgttttgacattatagcagcggtaaggtttggttt |
131 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| | ||||||| |||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
36410778 |
tgctgaaattcttcttaatcttgtttgttatgttgtattggttggtttgttatgcagtcaaagtctgttt-gacattatagcagcgggaaggtttggttt |
36410680 |
T |
 |
| Q |
132 |
atccgattttaaacattctgcactggtttttagtggagtatgctacccagagttttgggttatagtttctataagat |
208 |
Q |
| |
|
|| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36410679 |
attcgattttaaacattctgcactggtctttagtggagtatgctacccagagttttgggttatagtttatataagat |
36410603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 220 - 266
Target Start/End: Complemental strand, 36410584 - 36410538
Alignment:
| Q |
220 |
tatcatgctggagaagtctcatctgatcctacatcggtagctccttc |
266 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
36410584 |
tatcatgctggagaagtctcgtctgatcctacatatgtagctccttc |
36410538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University