View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16703_low_58 (Length: 206)

Name: NF16703_low_58
Description: NF16703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16703_low_58
NF16703_low_58
[»] chr1 (1 HSPs)
chr1 (19-195)||(52421846-52422022)
[»] chr4 (2 HSPs)
chr4 (19-195)||(14150419-14150595)
chr4 (38-177)||(14151098-14151237)
[»] chr2 (1 HSPs)
chr2 (19-177)||(24482332-24482488)


Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 52422022 - 52421846
Alignment:
19 gcatggttgaatgatgggagctgaaggttgcaagacgtggacgcttggagcgtgtacgtctcactgtggtcttttcacaagtgggtgaactattgctttt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52422022 gcatggttgaatgatgggagctgaaggttgcaagacgtggacgcttggagcgtgtacgtctcactgtggtcttttcacaagtgggtgaactattgctttt 52421923  T
119 agggagcacaaaatcctccttgttgactgatgatgatggatgttgctccacttttttcattgtaatattcttatcac 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
52421922 agggagcacaaaatcctccttgttgactgatgatgatggatgttgctccacttttttcattgtaatattctcatcac 52421846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 97; Significance: 7e-48; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 14150595 - 14150419
Alignment:
19 gcatggttgaatgatgggagctgaaggttgcaagacgtggacgcttggagcgtgtacgtctcactgtggtcttttcacaagtgggtgaactattgctttt 118  Q
    ||||||||||| || | | |||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||  ||  ||||||||| ||||||     
14150595 gcatggttgaacgaggtgggctgaaggttgcaagatgtggacgcttggtgcgtgtacgtctcattgtggtcttttcatgagcaggtgaactactgctttc 14150496  T
119 agggagcacaaaatcctccttgttgactgatgatgatggatgttgctccacttttttcattgtaatattcttatcac 195  Q
    | ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| ||| | ||||| |||||    
14150495 aaggagcacaaaatcctccttgttgaccgatgatgatggttgttgctccacttttttcactgtgagattctcatcac 14150419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 38 - 177
Target Start/End: Original strand, 14151098 - 14151237
Alignment:
38 gctgaaggttgcaagacgtggacgcttggagcgtgtacgtctcactgtggtcttttcacaagtgggtgaactattgcttttagggagcacaaaatcctcc 137  Q
    ||||||| ||||| |||||||||||||||||||||||||| ||| ||||||||||| |  ||||||||||||| |||||| | |||||||||||||||||    
14151098 gctgaagcttgcaggacgtggacgcttggagcgtgtacgtatcattgtggtctttttatgagtgggtgaactactgctttcatggagcacaaaatcctcc 14151197  T
138 ttgttgactgatgatgatggatgttgctccacttttttca 177  Q
    |||| ||||||||||||||| |||||||||||||||||||    
14151198 ttgtagactgatgatgatggttgttgctccacttttttca 14151237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 19 - 177
Target Start/End: Original strand, 24482332 - 24482488
Alignment:
19 gcatggttgaatgatgggagctgaaggttgcaagacgtggacgcttggagcgtgtacgtctcactgtggtcttttcacaagtgggtgaactattgctttt 118  Q
    ||||||||||| || || ||||| ||||| || ||| ||||||||||||| |||||||||||| ||| |||||| ||| ||||||||||||| ||||||     
24482332 gcatggttgaacga-ggaagctgcaggtt-catgacatggacgcttggagtgtgtacgtctcattgtagtctttccaccagtgggtgaactactgctttc 24482429  T
119 agggagcacaaaatcctccttgttgactgatgatgatggatgttgctccacttttttca 177  Q
    | ||||||| ||||||||||||||||| ||||||||||| ||||||| |||||||||||    
24482430 aaggagcaccaaatcctccttgttgaccgatgatgatggttgttgcttcacttttttca 24482488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University