View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16704_high_13 (Length: 248)
Name: NF16704_high_13
Description: NF16704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16704_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 46894117 - 46893895
Alignment:
| Q |
16 |
tctctctcgacacccaaattcaaacggagctatactctttggggatgcaccaaataacatgcattttggtcagggcaataattataataacaaaaacaac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46894117 |
tctctctcgacacccaaattcaaacggagctatactctttggggatgcaccaaataacatgcattttggtcagggcaataattataataacaaaaacaac |
46894018 |
T |
 |
| Q |
116 |
cctaatcttttcaataatttggtttacaccccattaacaattacacaacaaggagagtaccgtacacatgttacttccataagacttaatcagcacactg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46894017 |
cctaatcttttcaataatttggtttacaccccattaacaattacacaacaaggagagtaccgtatacatgttacctccataagacttaatcagcacactg |
46893918 |
T |
 |
| Q |
216 |
ttgttccagtgagtgcacctatg |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
46893917 |
ttgttccagtgagtgcacctatg |
46893895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University