View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16704_low_17 (Length: 235)
Name: NF16704_low_17
Description: NF16704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16704_low_17 |
 |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0015 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 25 - 188
Target Start/End: Original strand, 207237 - 207400
Alignment:
| Q |
25 |
tcttcgttttttcaatggagatatgatgtccctatctagcttgtcatcatttgcgaaatattcaagactaacatcaacaagataatcgtttttgtggatc |
124 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
207237 |
tcttcgtttttttaatggagatatgatgtccctatctattttgtcatcatttgagaaatattcaagagtaacatcaacaagataatcatttttgtggatc |
207336 |
T |
 |
| Q |
125 |
taggtaagtgtcggcttgggtggtgtgttgtttttggatttgcataataatagcacggaaaaga |
188 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
207337 |
taggtaagtgtcggcttgggtcgtgtgttgtttttggatttgcataataatagcacggaaaaga |
207400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 25 - 188
Target Start/End: Complemental strand, 21962500 - 21962337
Alignment:
| Q |
25 |
tcttcgttttttcaatggagatatgatgtccctatctagcttgtcatcatttgcgaaatattcaagactaacatcaacaagataatcgtttttgtggatc |
124 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
21962500 |
tcttcgtttttttaatggagatatgatgtccctatctattttgtcatcatttgagaaatattcaagagtaacatcaacaagataatcatttttgtggatc |
21962401 |
T |
 |
| Q |
125 |
taggtaagtgtcggcttgggtggtgtgttgtttttggatttgcataataatagcacggaaaaga |
188 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21962400 |
taggtaagtgtcggcttgggtcgtgtgttgtttttggatttgcataataatagcacggaaaaga |
21962337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 59 - 104
Target Start/End: Original strand, 39324396 - 39324441
Alignment:
| Q |
59 |
tctagcttgtcatcatttgcgaaatattcaagactaacatcaacaa |
104 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||| ||||| |||||| |
|
|
| T |
39324396 |
tctagtttgtcatcatttgcgaaatattcgagagtaacaacaacaa |
39324441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University