View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16705_high_8 (Length: 210)
Name: NF16705_high_8
Description: NF16705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16705_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 14 - 192
Target Start/End: Original strand, 18244969 - 18245147
Alignment:
| Q |
14 |
cacagaccagagaagtaatcaaaaggtgcttgttgagcatacaaaccaacatgtaggggtccttgcatagcttctctctcaccactcatgtgaggtaaaa |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18244969 |
cacacaccagagaagtaatcaaaaggtgcttgttgagcatacaaaccaacatgtaggggtccttgcatagcttctctctcaccactcatgtgaggtaaaa |
18245068 |
T |
 |
| Q |
114 |
catctaaaccatactcaaccctaccaccatgagcacaatgttggaaagaagtagcatatgggaaaatggacatactatt |
192 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18245069 |
catttaaaccatactcaaccctaccaccatgagcacaatgttggaaagaagtagcatattggaaaatggacatactatt |
18245147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University