View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16705_low_5 (Length: 266)
Name: NF16705_low_5
Description: NF16705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16705_low_5 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 12 - 266
Target Start/End: Original strand, 18244694 - 18244948
Alignment:
| Q |
12 |
aatactcgagggattagtctctgcagttgctcgcaaaggatgtctaatttacacccnnnnnnnnctaggttttcgtctctagtctactcgataaatttca |
111 |
Q |
| |
|
|||||| ||| |||||||||| ||||||||| ||| ||||||||| ||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18244694 |
aatacttgagagattagtctccgcagttgctagcagaggatgtctgatttacaacaaaaaaaaactaggttttcgtctctagtctactcgataaatttca |
18244793 |
T |
 |
| Q |
112 |
ctgttctaaattgcaatcgcggttgaagttatattgcgaacataaatattgtaatgcacttataaagaatacgcagcataacaacaaccgtgaccacaaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
18244794 |
ctgttctaaattgcaatcgcggttgaagttatattgcgaacataaatattgtaatgcacttataaagaatacgcatgttaacaacaaccacgaccacaaa |
18244893 |
T |
 |
| Q |
212 |
atcaatttatgaaaaccatggtgtctcctacaagaatatgaagtaaacaaaagag |
266 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18244894 |
atcaatttatgaaaaccatgttgtctcctacaagaatatgaagtaaacaaaagag |
18244948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 31113444 - 31113484
Alignment:
| Q |
12 |
aatactcgagggattagtctctgcagttgctcgcaaaggat |
52 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||| |||||| |
|
|
| T |
31113444 |
aatactcgagggattagtctccgcagttgcgcgcgaaggat |
31113484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 17 - 67
Target Start/End: Original strand, 46864206 - 46864256
Alignment:
| Q |
17 |
tcgagggattagtctctgcagttgctcgcaaaggatgtctaatttacaccc |
67 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| || |||||||||| |
|
|
| T |
46864206 |
tcgagggattagtctctgcagttgcgcgcaaaggatacctgatttacaccc |
46864256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 52
Target Start/End: Complemental strand, 36821107 - 36821071
Alignment:
| Q |
16 |
ctcgagggattagtctctgcagttgctcgcaaaggat |
52 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
36821107 |
ctcgagggattagtctctgcagttgcgcgcagaggat |
36821071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University