View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16705_low_9 (Length: 234)
Name: NF16705_low_9
Description: NF16705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16705_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 87 - 222
Target Start/End: Original strand, 48594223 - 48594359
Alignment:
| Q |
87 |
cattgccctattccattttttgccttttcacttatcccctgtgcaactttgaattagataattannnnnnnnact-nnnnnnnnggaaatatatgggact |
185 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
48594223 |
cattgccctattccattatttgccttttcacttatcccctgtgcaactttgaattagataattattttttttactaaaaaaaaaggaaatatatgggact |
48594322 |
T |
|
| Q |
186 |
taaaattgaagtaagtaagagggttaaggtgtttggt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48594323 |
taaaattgaagtaagtaagagggttaaggtgtttggt |
48594359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 48594129 - 48594178
Alignment:
| Q |
1 |
tcctctctcctctaatacactac--caccgtactcttttacatgtgtgtg |
48 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||| |||||||||||| |
|
|
| T |
48594129 |
tcctctctcctctaatacactaccacaccgtacccttatacatgtgtgtg |
48594178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University