View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16706_high_12 (Length: 330)
Name: NF16706_high_12
Description: NF16706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16706_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 18 - 320
Target Start/End: Complemental strand, 43816264 - 43815962
Alignment:
| Q |
18 |
tgaactcgggtcctttaaatcctttaaccgatagttcaaattagttgagctattcaaccctctaactattcaaatcagttaatcagtatttatgcttttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43816264 |
tgaactcgggtcctttaaatcctttaaccgatagttcaaattagttgagctattcaaccctctaactattcaaatcagttaatcagtatttatgcttttt |
43816165 |
T |
 |
| Q |
118 |
gatgtacaggtttggactcaaaaaatgttctgacatgggagaaacggtttcaaatcatatgtgggatagctgagggcttagcatatcttcatgagggatc |
217 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43816164 |
gatgtacaggtgtggactcaaaaaatgttctgacatgggagaaacggtttcaaatcatatgtgggatagctgagggcttagcatatcttcatgagggatc |
43816065 |
T |
 |
| Q |
218 |
tggaacaaaaattattcatagagacataaagtccagtaacattctacttgatgagtctctaaatccaaaaattgttgattttggtcttgctctctgtgct |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
43816064 |
tggaacaaaaattattcatagagacataaagtccagtaacattctacttgatgagtctctaaatccaaaaattgttgattttggtcttgctctttgtgtt |
43815965 |
T |
 |
| Q |
318 |
gct |
320 |
Q |
| |
|
||| |
|
|
| T |
43815964 |
gct |
43815962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University