View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16706_high_13 (Length: 317)
Name: NF16706_high_13
Description: NF16706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16706_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 6 - 300
Target Start/End: Original strand, 4133421 - 4133715
Alignment:
| Q |
6 |
attgttgctcgctctttagcagaggctgaatacattgccatttctgccttcacatctgagttattgtggcggcatagacaattattcagagcttttgatg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4133421 |
attgttgctcgctctttagcagaggctgaatacattgccatttctgccttcacatctgagttattgtggcggcatagacaattattcagagcttttgttg |
4133520 |
T |
 |
| Q |
106 |
ttattgttgatttaagtatggttaccaaaaatcgagttattttttatacagggccatttctaattttattaccaaataaaataaagatgagggaatgagg |
205 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4133521 |
ttattgttgatttaagtatggttactaaaaattgagttattttttatacagggccatttctaattttattaccaaataaaataaagatgagggaatgagg |
4133620 |
T |
 |
| Q |
206 |
agcaagtaatgtagctacctacctggatggtaacttcatcttcttcggcttcagacaggaagcatctccacctcattcaccggttgaggtgccac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4133621 |
agcaagtaatgtagctacctacctggatggtaacttcatcttcttcggcttcagacaggaagcatctccacctcattcaccggttgaggtgccac |
4133715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 24 - 117
Target Start/End: Complemental strand, 41080509 - 41080419
Alignment:
| Q |
24 |
gcagaggctgaatacattgccatttctgccttcacatctgagttattgtggcggcatagacaattattcagagcttttgatgttattgttgatt |
117 |
Q |
| |
|
|||||||||||||||| |||||| ||||| |||||||||||||||||| | |||||||||||| ||| |||||| |||||||||||||||| |
|
|
| T |
41080509 |
gcagaggctgaatacagggccattgctgccctcacatctgagttattgt---gacatagacaattactcacagctttagatgttattgttgatt |
41080419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 6 - 75
Target Start/End: Complemental strand, 41091877 - 41091808
Alignment:
| Q |
6 |
attgttgctcgctctttagcagaggctgaatacattgccatttctgccttcacatctgagttattgtggc |
75 |
Q |
| |
|
|||||||||||||||| |||||||||||||| | |||||| ||||| |||||||||||||| |||||| |
|
|
| T |
41091877 |
attgttgctcgctcttctgcagaggctgaatagagggccattgctgccctcacatctgagttactgtggc |
41091808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University