View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16706_high_9 (Length: 381)
Name: NF16706_high_9
Description: NF16706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16706_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 48 - 364
Target Start/End: Original strand, 43224465 - 43224782
Alignment:
| Q |
48 |
tatcgaaaggggtttctttttatttggtacacaatgatttgggtgttttggaatgtgagaaatgataggattttcaacagtagaattgtgaccatcaatg |
147 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43224465 |
tatcgaaaggggtttctttttatttggcacacaatgatttgggtgttttggaatgtgagaaatgataggattttcaactgtagaattgtgaccatcaatg |
43224564 |
T |
|
| Q |
148 |
agaattttggggatatcaaggttatgtcatggaagtagagtttgtgtagattgaaatggtcaccttgtctcttttacgagtgatgttgggatcctggcga |
247 |
Q |
| |
|
| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
43224565 |
aaatttttggggatatcaaggttatgtcatggaagtagagtttgtgtagattgaaatggtcaccttgtctcttttatgagtgatgttgggatcccggcga |
43224664 |
T |
|
| Q |
248 |
ttgtaatagcttg-nnnnnnnnggctatggggagggggcagctggataatttctgtacaggctgtttttgtctcggctagttcttgcaatcatgatttca |
346 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
43224665 |
ttgtaatagcttgtttttttttggctatggggagggggcagctggataatttctgtacaggctgtttttgtttcggctagttcttgcagtcatgatttca |
43224764 |
T |
|
| Q |
347 |
tgttgttctccgctgttc |
364 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43224765 |
tgttgttctccgctgttc |
43224782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University