View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16706_low_15 (Length: 255)
Name: NF16706_low_15
Description: NF16706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16706_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 59 - 239
Target Start/End: Complemental strand, 18279840 - 18279660
Alignment:
| Q |
59 |
acttaatatcaatatttttgtctttgcagtgaacaccaagctcaagatcggttaagttgttggtgatgtaaacagttaattttgacctatagaaaggaaa |
158 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18279840 |
acttaatatcattatttttgtctttgcagtgaacaccaagctcaagatcggttaagttgttggtgatgtaaacagttaattttgacctatagaaaggaaa |
18279741 |
T |
 |
| Q |
159 |
gctttgagagtatttaaactgcaaagaaacaagaattgttaataacatgaaaactaataacacaattttggagatcgaaat |
239 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18279740 |
gctttgagagtacttaaactgcaaagaaacaagaattgttagtaacatgaaaactgataacacaattttggagatcgaaat |
18279660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University