View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16706_low_15 (Length: 255)

Name: NF16706_low_15
Description: NF16706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16706_low_15
NF16706_low_15
[»] chr5 (1 HSPs)
chr5 (59-239)||(18279660-18279840)


Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 59 - 239
Target Start/End: Complemental strand, 18279840 - 18279660
Alignment:
59 acttaatatcaatatttttgtctttgcagtgaacaccaagctcaagatcggttaagttgttggtgatgtaaacagttaattttgacctatagaaaggaaa 158  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18279840 acttaatatcattatttttgtctttgcagtgaacaccaagctcaagatcggttaagttgttggtgatgtaaacagttaattttgacctatagaaaggaaa 18279741  T
159 gctttgagagtatttaaactgcaaagaaacaagaattgttaataacatgaaaactaataacacaattttggagatcgaaat 239  Q
    |||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||    
18279740 gctttgagagtacttaaactgcaaagaaacaagaattgttagtaacatgaaaactgataacacaattttggagatcgaaat 18279660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University