View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16707_low_2 (Length: 494)
Name: NF16707_low_2
Description: NF16707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16707_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 447; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 447; E-Value: 0
Query Start/End: Original strand, 11 - 485
Target Start/End: Original strand, 31698825 - 31699299
Alignment:
| Q |
11 |
agaagaagtgtgaaataggattggatatggaaaccaatactcatttaacataacatacttaaatgcccagatgcaaccatcttgcaagacatttgcaccc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31698825 |
agaagaagtgtgaaataggattggatatggaaaccaatactcatttaacataacatccttaaatgcccagatgcaaccatcttgcaagacatttgcaccc |
31698924 |
T |
 |
| Q |
111 |
tttgtgattgtgtgataaaccaaaaaatacactccttggatctgaaatccattttaggctgattgtaaggcatcagaaatgaaaagcaagcatgtccgat |
210 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31698925 |
tttgtgattgtgtgataaacccaaaaatacactccttggatctgaaatccattttaggctgattgtaaggcatcagaaatgaaaagcaagcatgtccgat |
31699024 |
T |
 |
| Q |
211 |
gttcttaaatccttgttatgaggtatggtaggaacttattaagtgtggcatggggaatataattagattgcagatgaacggagtctgttgataggtatac |
310 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31699025 |
gttcttaaatccttgttatgaggtagggtaggaacttattaagtgtggcatggggaatataattagattgctgatgaacggagtctgttgataggtatac |
31699124 |
T |
 |
| Q |
311 |
agcaatgtaaaaactgaaatcccattaggaaagcggtatggaggagggatgggcaagtagagttagacccttttatactatttgtcgatttatattcaac |
410 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
31699125 |
agcaatgcaaaaactgaaatcccattaggaaagcggtatggaggagggatgggcaagtagagttagacccttttatactatttgtcaatttattttcaac |
31699224 |
T |
 |
| Q |
411 |
caaaccattttggttagatgtgctagtcaatctatggatgatgccaaatttattgagaaattgtgcacaggttct |
485 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31699225 |
caaaccattttggttagatgtgctagtcaatctatggatgatgccaaatttattgagaaattgtgcacaggttct |
31699299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University