View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16707_low_7 (Length: 312)
Name: NF16707_low_7
Description: NF16707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16707_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 26495785 - 26495495
Alignment:
| Q |
1 |
tattttgaagaagggattgttgagagaattcaaaagggtgattgaatcaacaagaaaaaatggctaccgaggcgtttatgttaaaagaaagcgcctattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26495785 |
tattttgaagaagggattgttgagagaattcaaaagggtgattgaatcaacaagaaaaaatggctaccgaggcgtttatgttaaaagaaagcgcctattt |
26495686 |
T |
 |
| Q |
101 |
ttcattaagagcattgaagagtctttttgtgttattatcagctattgttatggtacttttgttaccatttagagggagaagaagggtatctcctgttgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26495685 |
ttcattaagagcattgaagagtctttttgtgttaatatcagctattgttatggtacttttgttaccatttagagggagaagaagggtatctcctgttgaa |
26495586 |
T |
 |
| Q |
201 |
aaagaagagaagatacaaaatcatgagtgttgtcatcatcatcggaaaggcacggtggtgcgcgttccggcaaagattgtgccatggaaga |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26495585 |
aaagaagagaagatacaaaatcatgagtgttgtcatcatcatcggaaaggcacggtggtgcgcgttccggcaaagattgtgccatggaaga |
26495495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University