View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16707_low_8 (Length: 304)
Name: NF16707_low_8
Description: NF16707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16707_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 182 - 242
Target Start/End: Complemental strand, 23126961 - 23126901
Alignment:
| Q |
182 |
gaaacccaatgtatgtgtgtaaccttgttttatcaacaaaggttcatgtgtattctatacc |
242 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
23126961 |
gaaacccaatgtatgtgtgtaaccttcttttatcaacaaaggttcatgtgtagtctatacc |
23126901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 237 - 297
Target Start/End: Complemental strand, 23126017 - 23125957
Alignment:
| Q |
237 |
tatacccatttgtggcaaggttattgataattgattgctagacctactagacgtgcctttg |
297 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||||||| | ||||||| |
|
|
| T |
23126017 |
tatacccatttatggcaaggttattgataattgattgctatacctactagatgggcctttg |
23125957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University