View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16709_high_10 (Length: 254)
Name: NF16709_high_10
Description: NF16709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16709_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 14 - 149
Target Start/End: Complemental strand, 7559013 - 7558878
Alignment:
| Q |
14 |
cttccatggttagagaacttgctatgagagtgagagcttttgagagtgtgctttgagaggtggtggttgtcgttttacggtgaggataagatattcggaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7559013 |
cttccatggttagagaacttgctatgagagtgagagcttttgagagtgtgctttgagaggtggtggttgtcgttttacagtgaggataagatattcggaa |
7558914 |
T |
 |
| Q |
114 |
atagataattttagaataaataatcaatttctcttc |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7558913 |
atagataattttagaataaataatcaatttctcttc |
7558878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University