View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16709_high_11 (Length: 240)
Name: NF16709_high_11
Description: NF16709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16709_high_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 226
Target Start/End: Complemental strand, 3715808 - 3715600
Alignment:
| Q |
18 |
gatcttaaatccatctttctataacttgtataattgaatggtactagtaggtgtatatgtcagatcccataaataataggctaaggatatttactgttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3715808 |
gatcttaaatccatctttctataacttgtataattgaatggtactagtaggtgtatatgtcagatcccataaataataggctaaggatatttactgttga |
3715709 |
T |
|
| Q |
118 |
ttatgttctagagcccaatctacctgtttatggaccacttaatttgaactaatgggtcacgaaatctaggactactcatatctttcaattacccctcact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
3715708 |
ttatgttctagagcccaatctacctgtttatggaccacttaatttgaactaatgggacaccaaatctaggactactcatacctttcaattaccccccact |
3715609 |
T |
|
| Q |
218 |
ttactcacc |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
3715608 |
ttactcacc |
3715600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University