View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16709_high_5 (Length: 407)
Name: NF16709_high_5
Description: NF16709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16709_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 13 - 64
Target Start/End: Complemental strand, 7111961 - 7111910
Alignment:
| Q |
13 |
atacttatgagatgatcaatgaaagtgtggagcgttagtaaaatgaaattag |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
7111961 |
atacttatgagatgatcaatgaaagtgtggcgcgttagtaaaattaaattag |
7111910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University