View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16709_high_7 (Length: 315)
Name: NF16709_high_7
Description: NF16709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16709_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 21 - 211
Target Start/End: Original strand, 6398273 - 6398481
Alignment:
| Q |
21 |
tgccactgttta-aatacacagcttatttgtagcttatagaa---caaaagcttgtgtat--------------agataggggtaatttgtttattacta |
102 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6398273 |
tgccactgtttagaatacacagcttatttgtagcttatagaagaacaaaagcttgtgtatgttattgtaatcatagataggggtaatttgtttattacta |
6398372 |
T |
 |
| Q |
103 |
actagtgtcaatgtgattttcaggactgtacttgnnnnnnnnatgaatttgcaatttacaacaacttagttgatttattttgtcacaagagatgaacaca |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6398373 |
actagtgtcaatgtgattttcaggactgtacttgttttttttatgaatttgcaatttacaacaacttagttgatttattttgtcacaagagatgaacaca |
6398472 |
T |
 |
| Q |
203 |
gaattaaga |
211 |
Q |
| |
|
||||||||| |
|
|
| T |
6398473 |
gaattaaga |
6398481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University