View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16709_low_15 (Length: 229)
Name: NF16709_low_15
Description: NF16709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16709_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 219
Target Start/End: Complemental strand, 4065974 - 4065771
Alignment:
| Q |
16 |
tttttaacatattctcttttttggtttaaaatcatataaatctcaccatatttgtattatggattcttatgaatgttgagtgtcatttttacaaggatct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065974 |
tttttaacatattctcttttttggtttaaaatcatataaatctcaccatatttgtattatggattcttatgaatgttgagtgtcatttttacaaggatct |
4065875 |
T |
|
| Q |
116 |
tgttctatgtgaataaactcactaagacaaagtgttttggactggcggtctagtgacccataatccttgccacctaaggtaggaaagaagacttctgtgc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4065874 |
tgttctatgtgaataaactcactaagacaaagtgttttggactggcggtctagtgacccataatccttgccacctaaggtgggaaagaagacttctgtgt |
4065775 |
T |
|
| Q |
216 |
tcct |
219 |
Q |
| |
|
|||| |
|
|
| T |
4065774 |
tcct |
4065771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University