View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16710_low_10 (Length: 238)
Name: NF16710_low_10
Description: NF16710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16710_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 4146844 - 4147044
Alignment:
| Q |
18 |
ggttatagccagccaaacataagtatcaaacttggagttggaaacacatgatgcgtttttccttagttagtctaattattattattgtttagctttgctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4146844 |
ggttatagccagccaaacataagtatcaaacttggagttggaaacacatgatgcgtttttccttagttagtctaattattattattgtttagctttgctt |
4146943 |
T |
|
| Q |
118 |
attttgttgaatgatgacttacttagtcttcgacaaatcttgtactctcttttgcttttcttatcaacgaaagagaaacatataatttataaggtgccag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4146944 |
attttgttgaatgatgacttacttagtcttcgacaaatcttgtactctcttttgcttttcttatcaacgaaagagaaacatataatttataaggtgccag |
4147043 |
T |
|
| Q |
218 |
a |
218 |
Q |
| |
|
| |
|
|
| T |
4147044 |
a |
4147044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 179
Target Start/End: Complemental strand, 46671729 - 46671654
Alignment:
| Q |
105 |
tttagctttgcttattttgttgaatgatgacttacttagtcttc-gacaaatcttgtactctcttttgcttttctt |
179 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| | |||| |||||||||||| |||||| || |||||||| |
|
|
| T |
46671729 |
tttagctttgcttattatggggaatgatgacttacttcgacttcagacaaatcttgtgctctctgttacttttctt |
46671654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University