View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16710_low_6 (Length: 306)
Name: NF16710_low_6
Description: NF16710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16710_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 14 - 287
Target Start/End: Complemental strand, 27656427 - 27656154
Alignment:
| Q |
14 |
aatatcatcaactgtaaatatttttagatcgtcaattaatatcgattgtcagataattaaaaatattttattatcattacgactatttctaaagttacac |
113 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||| |
|
|
| T |
27656427 |
aatatcatcaactgtaaatattgttagatcgtcaattaatatcgattgtcagataattaaaaatattttattttcattatgactacttctaaagttacac |
27656328 |
T |
 |
| Q |
114 |
atgtgatttgttatgatttattgatagcgttaaaagtatcttagaaaagtatgtactaaccacgattgtgaggcccctaaatgcatcaagagttgcaacc |
213 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27656327 |
atatgatttgttatgatttattgatagcgttaaaagcatcttagaaaagtatgtactaaccacgattgtgaggcccctaaatgcatcaagagttgcaacc |
27656228 |
T |
 |
| Q |
214 |
ctacnnnnnnngtgcttaacctcttgctcctttggtacttgctgaactgactctccctctagtgtggtccttat |
287 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27656227 |
ctactttttttgtgcttaatctcttgctcctttggtacttgctgaactgactctccctctagtgtggtccttat |
27656154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 168 - 214
Target Start/End: Original strand, 41310313 - 41310359
Alignment:
| Q |
168 |
actaaccacgattgtgaggcccctaaatgcatcaagagttgcaaccc |
214 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||| |||||||||| |
|
|
| T |
41310313 |
actaaccacaatggtgaggcccctaaatgcatcaagtgttgcaaccc |
41310359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University