View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16711_low_14 (Length: 216)
Name: NF16711_low_14
Description: NF16711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16711_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 37718003 - 37717799
Alignment:
| Q |
1 |
catcagtgttatcaaatagcggctatagcagaactgtaatgctttaacacagtggaactcaaacaaatcactattgttctgcgatgcgctatttagttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37718003 |
catcagtgttatcaaatagcggctatagcagaactgtaatgctttaacacagtggaactcaaacaaatcactattgttctgcgatgcgctatttagttca |
37717904 |
T |
|
| Q |
101 |
gagtgtttcaaatggctgcgctatagtcaatccgtgattgacaacactgttgtctatttatgtttatcatcattactttatgtgacagatagatattgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37717903 |
gagtgtttcaaatggctgcgctatagtcaatccgtgattgacaacactgttgtctatttatgtttatcatcattactttatgtgacagatagacattgtt |
37717804 |
T |
|
| Q |
201 |
ctgtg |
205 |
Q |
| |
|
||||| |
|
|
| T |
37717803 |
ctgtg |
37717799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 62 - 97
Target Start/End: Complemental strand, 1662697 - 1662662
Alignment:
| Q |
62 |
aacaaatcactattgttctgcgatgcgctatttagt |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1662697 |
aacaaatcattattgttctgcgatgcgctatttagt |
1662662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 97
Target Start/End: Complemental strand, 2843637 - 2843601
Alignment:
| Q |
61 |
aaacaaatcactattgttctgcgatgcgctatttagt |
97 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
2843637 |
aaacaaatcactattgttctgcgatacactatttagt |
2843601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University