View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16711_low_9 (Length: 277)
Name: NF16711_low_9
Description: NF16711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16711_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 8e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 40411617 - 40411527
Alignment:
| Q |
10 |
ctgagatgaaggacaacgtacgtattcagcttatatatatcatgtaacaaggttgtacactttgtactagcagtagtattcggcaagcaattat |
103 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40411617 |
ctgacatgaaggacaacgtacgtattcagtttatatatatcatgtaacaaggttgtacactttgtact---agtagtattcggcaagcaattat |
40411527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 203 - 277
Target Start/End: Complemental strand, 40411051 - 40410981
Alignment:
| Q |
203 |
atgttgccatctcaatgatttaatagttgggagggcaataatatatggaagtatatatgttctaagttagatcat |
277 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40411051 |
atgttgccatctctatgatttaatagttgggagggcaataatatatggaag----tatgttctaagttagatcat |
40410981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University