View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16712_high_13 (Length: 238)
Name: NF16712_high_13
Description: NF16712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16712_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 8)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 5 - 221
Target Start/End: Complemental strand, 13025214 - 13024998
Alignment:
| Q |
5 |
ccggacaaggatgatcctttttgggagagagatgtgcacgagctggatttgaatgacagtttttgggaggnnnnnnngctcatattcaacttgtatgacc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13025214 |
ccggacaaggatgatcctttttgggagagagatgtgcacgagctggatttgaatgacagtttttgggaggaaaaaaagctcatattcaacttgtatgacc |
13025115 |
T |
 |
| Q |
105 |
ctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgatggggttgatatgcctgcttcttgcccacattctctcgtgaacatgaatgg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13025114 |
ctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgatggggttgatatgcctgcttcttgcccacgttctctcgtgaacatgaatgg |
13025015 |
T |
 |
| Q |
205 |
attttgccattggttgt |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
13025014 |
attttgccattggttgt |
13024998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 99 - 156
Target Start/End: Complemental strand, 12712170 - 12712113
Alignment:
| Q |
99 |
atgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgatgg |
156 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
12712170 |
atgaccctttctgggagatatatagcctcaaaagtaactcttggaggaaaatcgatgg |
12712113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 9 - 156
Target Start/End: Original strand, 18096323 - 18096470
Alignment:
| Q |
9 |
acaaggatgatcctttttgggagagagatgtgcacgagctggatttgaatgacagtttttgggaggnnnnnnngctcatattcaacttgtatgacccttt |
108 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||| | || || |||||||| |||||||||||| |||||| |||| |||||||| || || |
|
|
| T |
18096323 |
acaaggatgaccctttttgggagactgatgtacacaaccttgacatgaatgacggtttttgggaggagaaggggctcattgtcaagttgtatgaaccatt |
18096422 |
T |
 |
| Q |
109 |
ctcggagatttatagcctcaaaagtaattcttggaggaaactcgatgg |
156 |
Q |
| |
|
| |||||| ||||||||||| || |||||||||||||||| ||||| |
|
|
| T |
18096423 |
ttgggagatgtatagcctcaagcgtgattcttggaggaaacttgatgg |
18096470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 99 - 148
Target Start/End: Original strand, 6117562 - 6117611
Alignment:
| Q |
99 |
atgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaa |
148 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
6117562 |
atgaccctttctgggagatatatagcctcaaaagtaactcttggaggaaa |
6117611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 95 - 156
Target Start/End: Complemental strand, 18139845 - 18139784
Alignment:
| Q |
95 |
ttgtatgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgatgg |
156 |
Q |
| |
|
|||||||| ||||| | |||||| ||||| ||||||||| |||||||||||||||| ||||| |
|
|
| T |
18139845 |
ttgtatgaacctttttgggagatatatagtctcaaaagtgattcttggaggaaacttgatgg |
18139784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 98 - 154
Target Start/End: Original strand, 12724620 - 12724676
Alignment:
| Q |
98 |
tatgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgat |
154 |
Q |
| |
|
||||| || |||| |||||| |||||||||| |||||| |||||||||||||||||| |
|
|
| T |
12724620 |
tatgaaccattcttggagatatatagcctcagaagtaactcttggaggaaactcgat |
12724676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 101 - 148
Target Start/End: Original strand, 12705461 - 12705508
Alignment:
| Q |
101 |
gaccctttctcggagatttatagcctcaaaagtaattcttggaggaaa |
148 |
Q |
| |
|
|||||||||| |||| | ||||||||||||||||| |||||||||||| |
|
|
| T |
12705461 |
gaccctttctgggagttatatagcctcaaaagtaactcttggaggaaa |
12705508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 18081889 - 18081962
Alignment:
| Q |
1 |
tttgccggacaaggatgatcctttttgggagagagatgtgcacgagctggatttgaatgacagtttttgggagg |
74 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||| ||| | || || |||| |||| ||||||||||| |
|
|
| T |
18081889 |
tttgccggacaaggatgaccctttttgggagattgatgtacaccaccttgacttgattgacgatttttgggagg |
18081962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 97 - 169
Target Start/End: Original strand, 17747850 - 17747923
Alignment:
| Q |
97 |
gtatgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaac-tcgatggggttgatatgcct |
169 |
Q |
| |
|
|||||||||||||| ||||| |||||||||| |||||| ||||||||||||| || ||||||||||||||||| |
|
|
| T |
17747850 |
gtatgaccctttctgtgagatatatagcctcataagtaactcttggaggaaacttcaatggggttgatatgcct |
17747923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 163
Target Start/End: Complemental strand, 22535565 - 22535498
Alignment:
| Q |
96 |
tgtatgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgatggggttgat |
163 |
Q |
| |
|
||||||||||||| | |||||| || ||||| | |||||| |||||||||||||| ||||| |||||| |
|
|
| T |
22535565 |
tgtatgaccctttttgggagatatacagccttagaagtaactcttggaggaaacttgatggtgttgat |
22535498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University