View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16712_high_19 (Length: 214)
Name: NF16712_high_19
Description: NF16712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16712_high_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 108 - 211
Target Start/End: Complemental strand, 14044187 - 14044084
Alignment:
| Q |
108 |
ttgaatatgagagtacaacagttgcaattccaaaaattgaacatcatgtagagttcatattcttgagaactatgatacaatgaaaaaataaggatgtggt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14044187 |
ttgaatatgagagtacaacagttgcaatttcaaaaattgaacatgatgtaaagttcatattcttgagaaatatgatacaatgaaaaaataaggatgtggt |
14044088 |
T |
 |
| Q |
208 |
aaga |
211 |
Q |
| |
|
|||| |
|
|
| T |
14044087 |
aaga |
14044084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 13929939 - 13929861
Alignment:
| Q |
1 |
cccgtattttgaacatagtatagtgggaaggatatattttggcccaaaatgtgaacgactatccatgtttggattgctc |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13929939 |
cccgtattttgaacatagtatagtgggaaggatatattttggcccaaaatgtggacgactatccatgtttggattgctc |
13929861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 133 - 211
Target Start/End: Complemental strand, 14039151 - 14039073
Alignment:
| Q |
133 |
aattccaaaaattgaacatcatgtagagttcatattcttgagaactatgatacaatgaaaaaataaggatgtggtaaga |
211 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14039151 |
aattccaaaaattgaacatgatgtaaagttcatattcttgagaactatgacacaatgaaaaaataaggatgtggtaaga |
14039073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 114 - 147
Target Start/End: Complemental strand, 14081514 - 14081481
Alignment:
| Q |
114 |
atgagagtacaacagttgcaattccaaaaattga |
147 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
14081514 |
atgagagcacaacagttgcaattccaaaaattga |
14081481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University