View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16712_low_18 (Length: 227)
Name: NF16712_low_18
Description: NF16712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16712_low_18 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 144 - 227
Target Start/End: Original strand, 42463663 - 42463746
Alignment:
| Q |
144 |
gtgactgaagtgtaatgaaaatgtgattattcattcagagtgtacttggcattatacttggaggtggtgctggtactcgtctat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42463663 |
gtgactgaagtgtaatgaaaatgtgattattcattcagagtgtacttggcattatacttggaggtggtgctggtactcgtctat |
42463746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 18 - 95
Target Start/End: Original strand, 42463537 - 42463614
Alignment:
| Q |
18 |
cttcatagctacattgtaattgctatcagaagaaaataatttttggtttctcttgtagattgaattgaaatatgtgaa |
95 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42463537 |
cttcatagctataatgtaattgttatcagaagaaaataatttttggtttctcttgtagattgaattgaaatatgtgaa |
42463614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University