View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16712_low_19 (Length: 214)

Name: NF16712_low_19
Description: NF16712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16712_low_19
NF16712_low_19
[»] chr6 (4 HSPs)
chr6 (108-211)||(14044084-14044187)
chr6 (1-79)||(13929861-13929939)
chr6 (133-211)||(14039073-14039151)
chr6 (114-147)||(14081481-14081514)


Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 108 - 211
Target Start/End: Complemental strand, 14044187 - 14044084
Alignment:
108 ttgaatatgagagtacaacagttgcaattccaaaaattgaacatcatgtagagttcatattcttgagaactatgatacaatgaaaaaataaggatgtggt 207  Q
    ||||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||    
14044187 ttgaatatgagagtacaacagttgcaatttcaaaaattgaacatgatgtaaagttcatattcttgagaaatatgatacaatgaaaaaataaggatgtggt 14044088  T
208 aaga 211  Q
    ||||    
14044087 aaga 14044084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 13929939 - 13929861
Alignment:
1 cccgtattttgaacatagtatagtgggaaggatatattttggcccaaaatgtgaacgactatccatgtttggattgctc 79  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
13929939 cccgtattttgaacatagtatagtgggaaggatatattttggcccaaaatgtggacgactatccatgtttggattgctc 13929861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 133 - 211
Target Start/End: Complemental strand, 14039151 - 14039073
Alignment:
133 aattccaaaaattgaacatcatgtagagttcatattcttgagaactatgatacaatgaaaaaataaggatgtggtaaga 211  Q
    ||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||    
14039151 aattccaaaaattgaacatgatgtaaagttcatattcttgagaactatgacacaatgaaaaaataaggatgtggtaaga 14039073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 114 - 147
Target Start/End: Complemental strand, 14081514 - 14081481
Alignment:
114 atgagagtacaacagttgcaattccaaaaattga 147  Q
    ||||||| ||||||||||||||||||||||||||    
14081514 atgagagcacaacagttgcaattccaaaaattga 14081481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University