View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16713_low_3 (Length: 209)
Name: NF16713_low_3
Description: NF16713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16713_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 108 - 191
Target Start/End: Complemental strand, 44886676 - 44886593
Alignment:
| Q |
108 |
acaccttcgacttggagaatctggctatgagactgttggtccagtcaccgttctccttgatgtgaacgctaaggtagtcatccc |
191 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44886676 |
acaccttcgacttggagaattcttttatgagactgttggtccagtcaccgttctccttgatgtgaacgctaaggtagtcatccc |
44886593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 31 - 82
Target Start/End: Original strand, 55635 - 55686
Alignment:
| Q |
31 |
ttaattatatattctctctaattaattgcaccatatcatttatcttcataac |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55635 |
ttaattatatattctctctaattaattgcaccatatcatttatcttcataac |
55686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University