View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16714_high_24 (Length: 311)
Name: NF16714_high_24
Description: NF16714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16714_high_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 30 - 295
Target Start/End: Original strand, 4161368 - 4161638
Alignment:
| Q |
30 |
agcacttgatagatgttgtgaacttaa----gtcacctgtcttatgataatttggggaagaaagacactgaccttgacttgagtgattttcttggaccta |
125 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4161368 |
agcacttgattgatgttgtgaacttaataaagtcacatgtcttatgataatttggggaagaaagacactgaccttgacttgtgtgattttcttggaccta |
4161467 |
T |
|
| Q |
126 |
aattgtgatgtttcctttgtataaattttgattttcgtattttgtaccacaataatagcaagagcaagttattgataaaacaaatgttggtgttttattg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4161468 |
aattgtgatgtttcctttgtataaattttgattttcgtattttgtaccacaataatagcaagagcaagttattgataaaacaaatgttggtgttttattg |
4161567 |
T |
|
| Q |
226 |
ctcttttgataccttgatatgaattatgattt-accactctatattcaaagatttgcatatgcaagatttt |
295 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4161568 |
ctcttttgttaccttgatatgaattatgatttaaccactctatattcaaagatttgcatatgcaagatttt |
4161638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University